You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden
Our papers are 100% unique and written following academic standards and provided requirements. Get perfect grades by consistently using our writing services. Place your order and get a quality paper today. Rely on us and be on schedule! With our help, you'll never have to worry about deadlines again. Take advantage of our current 20% discount by using the coupon code GET20
Order a Similar Paper Order a Different Paper
You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below.
These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email. Attachment is NOT acceptable.
Part 1 Bergey’s
Amy’s lab note for Unknown 47 test results is copied below.
Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown.
Complete the ID Report below. Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms.
Amy’s Unknown 47
Gram staining: appeared pink, rod shape
Colony diameter: about 1-2 mm
FTM: growth throughout
Durham glucose: yellow, bubble in the inverted glass vial
Durham lactose: yellow, bubble in the inverted glass vial
Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color
MSA: red, no growth
Semisolid stab: molds! tube appeared milky?
Gelatin stab: green mold on top of medium, gross!
Citrate test: green
Urease test: no color change
Catalase: bubbles
Endospore staining: red rods
Acid-fast staining: blue rods
Part 2 DNA Barcoding
Follow the following steps to identify your DB unknown.
The sequence of your DB unknown is copied below.
Type pubmed.gov into browser
Click on NCBI, National Center for Biotechnology Information (upper left corner)
Click on BLAST (right hand side, under ‘Popular Resources’)
Click on Nucleotide BLAST (nucleotide > nucleotide)
The page opens up is ‘Standard Nucleotide BLAST’
Enter your sequence to the box ‘Enter Query Sequence’
Leave everything as default (that is, do not change setting)
Scroll down
Click on ‘BLAST’ button on the lower left
Wait for a few seconds
Scroll down to review the results
Answer questions in the ID Report below.
DB#5
AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG
CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA
TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT
GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG
CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG
GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT
AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA
GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC
GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG
ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT
ID Report
Your Name –
Part 1 Bergey’s
Amy’s Unknown Number – _____; Identification –
A. Interpret all of Amy’s Unknown test results listed in Part I above:
B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc. It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.)
C. One paragraph describing the disease(s) this unknown bacterium may cause:
D. Reference citation: (cite the sources of information)
Part 2 DNA Barcoding
Unknown DB Number – _____; Identification –
1. What is the name this unknown bacterium according to the NCBI BLAST sequence analysis?
2. Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____?
3. Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1). Name another two test results that can support your answer to (2).
You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden
You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below. These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email. Attachment is NOT acceptable. Part 1 Bergey’s Amy’s lab note for Unknown 47 test results is copied below. Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown. Complete the ID Report below. Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms. Amy’s Unknown 47 Gram staining: appeared pink, rod shape Colony diameter: about 1-2 mm FTM: growth throughout Durham glucose: yellow, bubble in the inverted glass vial Durham lactose: yellow, bubble in the inverted glass vial Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color MSA: red, no growth Semisolid stab: molds! tube appeared milky? Gelatin stab: green mold on top of medium, gross! Citrate test: green Urease test: no color change Catalase: bubbles Endospore staining: red rods Acid-fast staining: blue rods Part 2 DNA Barcoding Follow the following steps to identify your DB unknown. The sequence of your DB unknown is copied below. Type pubmed.gov into browser Click on NCBI, National Center for Biotechnology Information (upper left corner) Click on BLAST (right hand side, under ‘Popular Resources’) Click on Nucleotide BLAST (nucleotide > nucleotide) The page opens up is ‘Standard Nucleotide BLAST’ Enter your sequence to the box ‘Enter Query Sequence’ Leave everything as default (that is, do not change setting) Scroll down Click on ‘BLAST’ button on the lower left Wait for a few seconds Scroll down to review the results Answer questions in the ID Report below. DB#5 AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT ID Report Your Name – Part 1 Bergey’s Amy’s Unknown Number – _____; Identification – A. Interpret all of Amy’s Unknown test results listed in Part I above: B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc. It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.) C. One paragraph describing the disease(s) this unknown bacterium may cause: D. Reference citation: (cite the sources of information) Part 2 DNA Barcoding Unknown DB Number – _____; Identification – 1. What is the name this unknown bacterium according to the NCBI BLAST sequence analysis? 2. Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____? 3. Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1). Name another two test results that can support your answer to (2).

We offer the best essay writing services to students who value great quality at a fair price. Let us exceed your expectations if you need help with this or a different assignment. Get your paper completed by a writing expert today. Nice to meet you! Want 15% OFF your first order? Use Promo Code: FIRST15. Place your order in a few easy steps. It will take you less than 5 minutes. Click one of the buttons below.
Order a Similar Paper Order a Different Paper