Protein engineering

 

The report must be submitted as a Word file.  All sequences (protein and DNA) must be shown in fixed-width “Courier new” fonts to facilitate sequence comparisons. Use one-letter amino acid code for polypeptide sequences.

 

• Ligation-independent Cloning 75 points total

A startup is developing an anti-inflammatory biological drug based on the human progranulin (see homework 2 for the amino acid sequence). The chimeric protein has to have hGrnA (the third granulin repeat in the sequence) merged at its C-terminus with hGrnD (human granulin D, the fifth granulin repeat in the sequence). To facilitate DNA manipulations, the hGrnA expression vector you obtained in homework 2 has been modified in such a way that a unique XhoI recognition site (c|tcgag, used to clone hGrnA in homework 2) was replaced with a unique PvuII site (cag|ctg). You will need to digest with PvuII the vector for hGrnA expression, and insert the hGrnD sequence.

You employ the In-fusion cloning technique and your tasks are:

• Identify the amino acid sequence (5 points) and the back-translated nucleotide sequence of hGrnD for insertion (5 points).
• Show the modified (XhoI->PvuII) recombinant DNA nucleotide sequence of the hGrnA construct encoding the entire amino acid sequence starting from the initiator methionine and ending with the stop codon (use the nucleotide sequence created in task 5 of homework 2 as a starting point). Make sure that PvuII is unique and, if necessary, replace nucleotides with those compatible for expression using the codon degeneracy. Underline or highlight the unique PvuII site (10 points)
• Design two primers (one forward and one reverse) with properties that are suitable for In-Fusion cloning. Label the vector-specific and insert-specific parts (25 points).
• Indicate the length, melting temperature, GC content of your primers (using the unique insert-specific parts) and the melting temperature difference between them (10 points).
• Show the final nucleotide sequence of the chimeric construct after cloning. Label the coding region for the chimeric protein (10 points).
• Translate the protein-coding region of the chimeric clone to amino acid sequence using Expasy Translate tool. Label amino acids that belong to the two different granulins (10 points).

Tools:

NEB Cutter: http://nc2.neb.com/NEBcutter2/

Use 0 and 1 cutters links to identify restriction enzymes that make 0 and 1 cut in the supplied sequence

Reverse Complement: http://www.bioinformatics.org/sms/rev_comp.html

Expasy Translate Tool: http://web.expasy.org/translate/

BamHI info: https://www.neb.com/products/r0136-bamhi

 

• Truncated fragments (25 points)

You have a nucleotide sequence coding FliS (bacterial flagellin-specific chaperone) in an expression plasmid. You want to express a truncated fragment that will contain the first 40 residues only (an N-terminal fragment) in the same plasmid. What will be the easiest way to make this construct (5 points)? What partially overlapped primers will you use for this task (15 points)? Partially overlapped regions should have 50-52°C melting temperatures, while non-overlapping annealing regions should have 68-70°C melting temperatures. Explain your approach (5 points)

 

atgtacaccgcgagcggtatcaaagcttatgcgcaagtcagcgtggaaagcgccgtgatgagcgccagcccgcatcagttgattgaaatgttgtttgatggcgcgaatagcgctctggtgcgcgctcgcctgtttttagaacaaggcgatgttgtcgcgaaaggtgaagcgttaagcaaagccatcaatattatcgataacgggctgaaagccggcctcgatcaggaaaaaggcggtgagattgcgacgaatctttccgagctatacgactatatgattcgccgtttactgcaggctaatttgcgtaacgacgctcaggccatcgaagaagtggaagggttactcagcaatattgcagaagcctggaagcagatttcaccgaaagcatctttccaggagtctcgttaa