a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene…
Ace your studies with our custom writing services! We've got your back for top grades and timely submissions, so you can say goodbye to the stress. Trust us to get you there!
Order a Similar Paper Order a Different Paper
a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3’gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5′ (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
Looking for top-notch essay writing services? We've got you covered! Connect with our writing experts today. Placing your order is easy, taking less than 5 minutes. Click below to get started.
Order a Similar Paper Order a Different Paper
