Genetic Probability Problem for Basic Biology Questions

I’m working on a biology writing question and need an explanation and answer to help me learn.

1. In aliens the inability to digest carbon is an autosomal recessive trait. The ability to
digest carbon is dominant. If a female that can digest carbon, with a father that could
not digest carbon, has an offspring with a male that cannot digest, what is the
probability that:

a. Their offspring will be able to digest carbon.

b. Their offspring will not be able to digest carbon.

c. What is/are the possible genotype(s) of the mother?

2. In a special type of squirrels black spots is dominant over no spots. A fluffy tail is
dominant over a smooth tail. A squirrel with no spots and that is homozygous dominant
for a fluffy tail is mated with the squirrel that is heterozygous for both black spots and a
fluffy tail. Please give the genotypic and phenotypic ratio for this problem and show your
work.

3. Below is a strand of DNA. Transcribe and translate it correctly like we did in class
(pretend you are the ribosome)!

3’promoterTTGGCATACTTGGACGGGCCCTATAAAATTGCGATC

5’ AACCGTATGAACCTGGGCGGGATATTTTAACGCTAG